don't get it?

In organisms, somatic cells reproduce via ______, while a gamete will divide using _____, once gametes are mature they can execute _____________ resuting in a fertilized egg called a ______.

Select one:

A. mitosis, meiosis, sexual reproduction, zygote

B. zygote, sexual reproduction, mitosis, meiosis

C. sexual reprodction, meiosis, mitosis, ovum

D. meiosis, sexual reproduction, zygote, ovum

Update:

After DNA replication, the DNA molecules that are made:

Select one:

A.are complimentary

B.are identical

C.must replicate again

D.cannot replicate again

Update 2:

__________ is cell division in which the diploid number is reduced by one half for the formation of gametes

Select one:

A. Mitosis

B. Meiosis

C. Sexual Reproduction

D. Cell Cycle

Update 3:

What amino acid sequence will be generated based on the following mRNA codon sequence? (assume a left to right reading frame)

AUGUCUUCGUUAUCCUUGUUA

Select one:

A. met-arg-glu-arg-glu-arg-leu

B. met-glu-arg-arg-gln-leu-ser

C. met-ser-leu-ser-leu-ser-stop

D. met-ser-ser-leu-ser-leu-leu

E. leu-leu-ser-leu-ser-ser-met

Update 4:

What is one difference in mitosis and meiosis during anaphase I?

Select one:

A. the chromosomes line up at the equator in anaphase I of meiosis.

B. centromeres do not exist in anaphase I.

C. chromatids do not separate at the centromere in anaphase I of meiosis

D. crossing-over occurs only in anaphase of mitosis

Update 5:

The site at which tRNA will first make contact with the mRNA strand is the:

Select one:

A. A site

B. P site

C. E site

D. B site

1 Answer

Relevance
  • 6 years ago

    A

Still have questions? Get your answers by asking now.